View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_19 (Length: 334)
Name: NF13038_low_19
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 9 - 143
Target Start/End: Complemental strand, 30957107 - 30956973
Alignment:
| Q |
9 |
gagatgaatccaaagccggctaacagaataaatctgtaagcaaacttctaagacttttccactttacaccacacattcacttgaccatacatctttaggt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957107 |
gagatgaatccaaagccggctaacagaataaatctgtaagcaaacttctaagacttttccactttacaccacacattcacttgaccatacatctttaggt |
30957008 |
T |
|
| Q |
109 |
aatgcctatgcccttcatttgtctcttcctcaaac |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30957007 |
aatgcctatgcccttcatttgtctcttcctcaaac |
30956973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 206 - 315
Target Start/End: Complemental strand, 30956910 - 30956801
Alignment:
| Q |
206 |
atagaattaaatttcaacaaaaacaacctaggttttgataactaattcaccatggaattcagctaccttcaagatgattcaaagagctcgagcgatgaaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30956910 |
atagaattaaatttcaacaaaaacaacctaggttttgataactaattcaccatggaattcagctaccttcaagatgattcaaagagctcgagcgatgaaa |
30956811 |
T |
|
| Q |
306 |
acatcgatcg |
315 |
Q |
| |
|
|||||||||| |
|
|
| T |
30956810 |
acatcgatcg |
30956801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University