View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_26 (Length: 268)
Name: NF13038_low_26
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 46 - 253
Target Start/End: Original strand, 43612235 - 43612442
Alignment:
| Q |
46 |
cttggagtttttcttgttgttggggttttcactctgcctcacttgttcttgtgactctgaggcaacagatactatttcctgaagccttgaacaaggaagc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43612235 |
cttggagtttttcttgttgttggggttttcactctgcctcacttgttcttgtgactctgaggcaacagatactatttcctgaagccttgaacaaggaagc |
43612334 |
T |
 |
| Q |
146 |
ctgtgttgtctgagaagtggagaagagagtaactgctgccggtggcgggcgtagtatgggaaagagtgctgctgctgtgacagtggctgccaaattggaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43612335 |
ctgtgttgtctgagaagtggagaagagagtaactgctgccggtggcggccgtagtatgggaaagagtgctgttgctgtgacagtggctgccaaattggaa |
43612434 |
T |
 |
| Q |
246 |
aagctttg |
253 |
Q |
| |
|
|||||||| |
|
|
| T |
43612435 |
aagctttg |
43612442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University