View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_29 (Length: 253)
Name: NF13038_low_29
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_29 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 253
Target Start/End: Original strand, 41188234 - 41188465
Alignment:
| Q |
18 |
gcttgtgcataccttgagattgaggattgaaagtgaaattcagttagatggtgaagaagaagaagaaacagagaaagtgtgtgtgcgatggagatggagt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41188234 |
gcttgtgcataccttgggattgaggattgaaagtgaaattaagttagatggtgaagaagaagaagaaacagagaaagtgtgtgtgcgatggagatggagt |
41188333 |
T |
 |
| Q |
118 |
tggtgttggaagtgcgggtgggtttacgtgtaatggcacggaaatattgaaaattcttcttccactttcagtttcacaacacaaacccctttcatttcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41188334 |
tggtgttggaagtgcgggtgggtttacgtgtaatggcacggaaatattgaaaattcttcttccactttcagtttcacaacacaaacccctttcctttca- |
41188432 |
T |
 |
| Q |
218 |
ctttctttctttatttatatctatatctccaccgtt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
41188433 |
---tctttctttatttatatctatatctccaccgtt |
41188465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University