View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_30 (Length: 250)
Name: NF13038_low_30
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_30 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 103 - 250
Target Start/End: Original strand, 46862857 - 46863004
Alignment:
| Q |
103 |
ttcacatatgcatgcacctttgcagcctctgataattagaggtggttactacctttataattaattagagacaaaaagactgttaatgatgatgataagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46862857 |
ttcacatatgcatgcacctttgcagcctctgataattagaggtggttactaactttataattaattagagacaaaaagactgctaatgatgatgataagt |
46862956 |
T |
 |
| Q |
203 |
gattaaaatatagcaccaatgatgataattgatttgtatcttggacct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46862957 |
gattaaaatatagcaccaatgatgataattgatttgtatcttggacct |
46863004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 46862471 - 46862556
Alignment:
| Q |
16 |
attatgtgaaaaaacaaaccgaagtatcttgaaacttattgaccaatacaaagaaagaaaagagaaaatatacatagataaatatt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46862471 |
attatgtgaaaaaacaaaccgaagtatcttgaaacttattgaccaatacaaagaaagaaaagagaaaatatacatagataaatatt |
46862556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University