View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13038_low_36 (Length: 213)
Name: NF13038_low_36
Description: NF13038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13038_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 28022955 - 28022775
Alignment:
| Q |
19 |
aaagtatcaaggggaatgccccaatatcgtgaaactttgtcgcacaggtcactcaccttgtcggtctccttcaccctcacatagccattgctgccatggc |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022955 |
aaagtatcaaggggaatgccccaataccgtgaaactttgttgcacaggtcactcaccttatcggtctccttcaccctcacatagccattgctgccatggc |
28022856 |
T |
|
| Q |
119 |
caagaaacttcactaaaacatgtagtttcaggtctgatggcagtggatcaacaatgagagtaactgtttctgtttcatctc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022855 |
caagaaacttcactaaaacatgtagtttcaggtctgatggcagcggatcaacaatgagagtaactgtttctgtttcatctc |
28022775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University