View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13039_high_6 (Length: 417)
Name: NF13039_high_6
Description: NF13039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13039_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 272 - 401
Target Start/End: Original strand, 29472114 - 29472243
Alignment:
| Q |
272 |
tttagttttgtaatttgtctttggttagagataaaatttaaaaatatcaaacggccccagttaaggaaacatatactaaatgagagttaggtctagtttt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29472114 |
tttagttttgtaatttgtctttggttagagataaaatttaaaaatatcaaacggccccagttaaggaaacatataccaaatgagagttaggtctagtttt |
29472213 |
T |
|
| Q |
372 |
atgttgttgttattatgttaggtagaacat |
401 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
29472214 |
atgttgttattattatgttaggtagaacat |
29472243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University