View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1303_high_2 (Length: 434)
Name: NF1303_high_2
Description: NF1303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1303_high_2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 96 - 434
Target Start/End: Original strand, 17395925 - 17396263
Alignment:
| Q |
96 |
acattttgttgagggggagtcggttgaggttgaaacttaaaccgataaggtgtaaaatcaaacggttctgattcctggtctggttgagggggagccgatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17395925 |
acattttgttgagggggagtcggttgaggttgaaacttaaaccgataaggtgtaaaatcaaacggttctgattcctggtctggttgagggggagccgatt |
17396024 |
T |
|
| Q |
196 |
gggtcggttgaggttgaaacttatacgtataaggagtgatatcacacgattctgcttcttcnnnnnnntcaaacgattctggttgctggtccggttgggg |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
17396025 |
gggtcggttgaggttgaaacttatacgtataaggggtaaaatcacacgattctgcttcttcaaaaaaatcaaacgattctggttgttggtctggttgggg |
17396124 |
T |
|
| Q |
296 |
ctttatattgtcatcttttatcccctcactatcaaaccaagatttgtcaatgacagcaggacgaacaatgcagttactcggttcctcacttactcctttt |
395 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17396125 |
ctttatattgtcatcttttatcacctcactatcgaaccaagatttgtcaatgacagtaggacgaacaatgcagttactcggttcctcacttactcctttt |
17396224 |
T |
|
| Q |
396 |
gccacacaaagtaagtggatgatagaagaatgccccaac |
434 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17396225 |
gtcacacaaagtaagtggatgatagaagaatgccccaac |
17396263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University