View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1303_low_18 (Length: 252)
Name: NF1303_low_18
Description: NF1303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1303_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 87 - 222
Target Start/End: Complemental strand, 53285592 - 53285457
Alignment:
| Q |
87 |
ataccttcactaaaaattttagtatcacattccatccaaagaaaagagtataacatcgcataagaacgggtcattgtgttttgatacaaaaaggtaaaag |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53285592 |
ataccttcactaaaaaatttagtatcacattcgatccaaagaaaagagtataacatcgcataagaacgggtcattgtgttttgatacaaaaaggtaaaag |
53285493 |
T |
|
| Q |
187 |
aattaggcttcgaagactaaatatttactgagttat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53285492 |
aattaggcttcgaagactaaatatttactgcgttat |
53285457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 53288762 - 53288676
Alignment:
| Q |
1 |
ttatatttaagaaggaaggtagtagtagtaaaattatgtgcctgttttctacacaaagtattcttataaaggataatattatagaaa |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53288762 |
ttatatttaagaaggaaggtagtagtagtaaaattatgtgcctgttttctacacaaagtattcttataaaggataatattatagaaa |
53288676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University