View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1303_low_22 (Length: 212)

Name: NF1303_low_22
Description: NF1303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1303_low_22
NF1303_low_22
[»] chr6 (1 HSPs)
chr6 (1-92)||(14513496-14513587)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 14513496 - 14513587
Alignment:
1 tgatattaagattcttgttcttaaacttgaaattaatgaatgaaaaggtttatgtgtctttttcattggttttgttcttcaccttggatatt 92  Q
    |||||||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
14513496 tgatattaagattcttgttcctaaacttgaaattaatcaatgagaaggtttatgtgtctttttcattggttttgttcttcaccttggatatt 14513587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University