View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1303_low_24 (Length: 206)
Name: NF1303_low_24
Description: NF1303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1303_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 51752529 - 51752404
Alignment:
| Q |
1 |
tgtgggtggtggaaccggatctggtttgggttctcttctgttggagcgtttatctgttgattacggtaaaaaatccaagttgggttttaccgtttatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51752529 |
tgtgggtggtggaaccggatctggtttgggttctcttctgttggagcgtttatctgttgattacggtaaaaaatccaagttgggttttaccgtttatcca |
51752430 |
T |
|
| Q |
101 |
tctccccaggtttctacctctgtggt |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
51752429 |
tctccccaggtttctacctctgtggt |
51752404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 5 - 78
Target Start/End: Complemental strand, 35670158 - 35670085
Alignment:
| Q |
5 |
ggtggtggaaccggatctggtttgggttctcttctgttggagcgtttatctgttgattacggtaaaaaatccaa |
78 |
Q |
| |
|
|||||||||||||| |||||| ||||||| || || ||||| ||| | ||||||||||| || || |||||||| |
|
|
| T |
35670158 |
ggtggtggaaccggttctggtctgggttcactccttttggaacgtctttctgttgattatggaaagaaatccaa |
35670085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University