View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_18 (Length: 558)
Name: NF13040_high_18
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 276
Target Start/End: Complemental strand, 40872626 - 40872357
Alignment:
| Q |
7 |
agtcccatgagaaggttcctttagatggtttactttcaagggaacaaggtcccttttctcattttatgataccttaaccattattagaaacatatccaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40872626 |
agtcccatgagaaggttcctttagatggtttactttcaagggaacaaggtcccttttctcattttatgataccttaaccattattagaaacatatccaaa |
40872527 |
T |
 |
| Q |
107 |
tagatttatttcatcaccaataagactaaagtaacagtagtacgcacaaacatcccaatctattttgggtaaaatgttacacaaataacaaaaacatcac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40872526 |
tagatttatttcatcaccaataagactaaagtaacagtagtacgcacaaacatcccaatctattttgggtaaaatgttacacaaataacaaaaacatcac |
40872427 |
T |
 |
| Q |
207 |
tatcatttctttttatttgaagggctaggatcttcactgttcttgcaattataaacttagcactaacaaa |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40872426 |
aatcatttctttttatttgaagggctaggatcttcactgttcttgcaattatagacttagcactaacaaa |
40872357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 255; E-Value: 1e-141
Query Start/End: Original strand, 277 - 543
Target Start/End: Complemental strand, 40872315 - 40872049
Alignment:
| Q |
277 |
tttgtttatgtatgcaagtgtaaaaggtaaatttaaatcacaccccaaatcgaaccgaactaaacattagcattctggagtaagtgtatggtctctctta |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40872315 |
tttgtttatgtatgcaagtgtaaaaggtaaatttaaatcacaccccaaattgaaccgaactaaacattagcattctggagtaagtgtatggtctctctta |
40872216 |
T |
 |
| Q |
377 |
ggatcatgacaataatcatagaccaagtaattattttggacccattgcattgcaacattttgctgacggctcagcttgccgccatagccgggtggtgaga |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40872215 |
ggatcatgacaataatcatagaccaagtaatttttttggacccattgcattgcaacattttgctgacggctcagcttgccgccatagccgggtggtgaga |
40872116 |
T |
 |
| Q |
477 |
cagaaggcggccggcatgaggaggtggaatcagtggtacaaccttgtagtttgaagttttggtatct |
543 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40872115 |
cagaaggtggccggcatgaggaggtggaatcagtggtacaaccttgtagtttgaagttttggtatct |
40872049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University