View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_65 (Length: 274)
Name: NF13040_high_65
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 257
Target Start/End: Complemental strand, 41094381 - 41094134
Alignment:
| Q |
10 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094381 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
41094282 |
T |
 |
| Q |
110 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094281 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaat |
41094182 |
T |
 |
| Q |
210 |
ccttcatagttactattattgtcatcttcaaaaggtcctcctactact |
257 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41094181 |
ccttcatagttactattgttgtcatcttcaaaaggtcctcctactact |
41094134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University