View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_71 (Length: 266)
Name: NF13040_high_71
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_71 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 6 - 266
Target Start/End: Original strand, 33947934 - 33948194
Alignment:
| Q |
6 |
ccaagaatatactataattaatgatagcaaggaaaacaattggtagtctagtaaaggctgctccttctaaaaaccagtctagtccttcactcaaaagtca |
105 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33947934 |
ccaagaaaatactataattaatgatagcaaggaaaacaattggtagtctagtaaaggctgctccttctaaaaaccagtctagtccttcactcaaaagtca |
33948033 |
T |
|
| Q |
106 |
atctttcccactcatacccccctctttcctctatccttccccacttcccttctctatataatcaccccttcacattccaaccgacacccattttccattt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33948034 |
atctttcccactcatacccccctctttcctctatccttccccacttcccttctctatataatcaccccttcacattccaaccgacacccattttccattt |
33948133 |
T |
|
| Q |
206 |
ccaccatagcaactgtttggtttggaatttggttccacaaacaagcatggaggttgttcta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33948134 |
ccaccatagcaactgtttggtttggaatttggttccacaaacaaacatggaggttgttcta |
33948194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University