View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_83 (Length: 245)
Name: NF13040_high_83
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_83 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 14 - 227
Target Start/End: Complemental strand, 52704593 - 52704380
Alignment:
| Q |
14 |
taatattgaagctcgatgttcacagtttcgacaacacaaatgcaacgtgattgatctttaagataacacaactatttgactttcacaagtcacgactaga |
113 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52704593 |
taatattgaagctcgattttcatagtttcgacaacacaaatgcaacgtgattgatcttcaagataacacaactatttgactttcacaagtcacgactaga |
52704494 |
T |
 |
| Q |
114 |
aggagtgtattcaaatcata-ttctttttatcttgacgttctaatactgaaatagtttagtagaatgcatcttaacgagcgaatttattggttggagacc |
212 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||||||||||||||| ||||||| ||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52704493 |
aggagcatattcaaatcatatttttttttatcttgacgttctaatactgagatagtttggta-aatgcatcttaacgaacgaatttattggttggagacc |
52704395 |
T |
 |
| Q |
213 |
ttagtacaggctctg |
227 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
52704394 |
ttactacaggctctg |
52704380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University