View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_86 (Length: 240)
Name: NF13040_high_86
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_86 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 115 - 225
Target Start/End: Complemental strand, 34038688 - 34038578
Alignment:
| Q |
115 |
ttatgattcttcgattatgaaaagaacaaattaataagtatagatatctacaaagaaatcacatgatactttctaaaattattgagatgcaaaagctaaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34038688 |
ttatgattcttcgattatgaaaagaacaaattaataagtatagatatctacaaagaaatcacatgatactttctaaaattattgagatgcaaaagctaaa |
34038589 |
T |
|
| Q |
215 |
ataatcatagt |
225 |
Q |
| |
|
| ||||||||| |
|
|
| T |
34038588 |
agaatcatagt |
34038578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 4 - 84
Target Start/End: Complemental strand, 34038752 - 34038672
Alignment:
| Q |
4 |
acaaatatgtatgcctagtttagattagtttttggtttacataatcttgttgatcaaaataaatttatgattgtttgatta |
84 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
34038752 |
acaaatatgtatgcgtagtttagattagtttttggtttacataatcttgttgatcaaaataaatttatgattcttcgatta |
34038672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University