View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_high_97 (Length: 211)
Name: NF13040_high_97
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_high_97 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 31950578 - 31950368
Alignment:
| Q |
1 |
tgaaacggaaggagtagcatatagtgcattattgtccatcattttcttgattccattatcatcaaggctgaactctttcggcgttcttgctttgttcttc |
100 |
Q |
| |
|
|||||| || |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31950578 |
tgaaacagagggagtaacatatagtgcattaatgtccatcattttcttgattccattatcatcaaggctgaactctttcggcgtttttgctttgttcttc |
31950479 |
T |
 |
| Q |
101 |
ttgactaattttatttagccacaatgaagacaacattgttgattgtattttgcttcaaacagtattttctcttctctttgcgtggacctaaataaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
31950478 |
ttgactaattttatttagccacaatgaagacaacattgttgattgtattttgcttcaaacggtattttttcttctctttgcatggacctaaataaaatta |
31950379 |
T |
 |
| Q |
201 |
aaactaaaatg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
31950378 |
aaactaaaatg |
31950368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University