View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_40 (Length: 384)
Name: NF13040_low_40
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 194 - 350
Target Start/End: Complemental strand, 3609820 - 3609663
Alignment:
| Q |
194 |
tttcttgatataccaatcatatatcaaagttaaaattctagtttcttatgtttcaagcttgtggatttaagagccataaatttgatgagatgataagagt |
293 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
3609820 |
tttcttgatttacaaatcatatatcaaagttaaaattctagtttcttatgtttcaagcttgttgatttaagagccataaatttgataagatgttaagagt |
3609721 |
T |
|
| Q |
294 |
ttaatgttctccagttaaaa-cttcatcacaaaaatgtcacccttcttgatctatgaa |
350 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3609720 |
ttaataatctcgagttaaaatattcatcacaaaaatgtcatccttcttgatctatgaa |
3609663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 11 - 115
Target Start/End: Complemental strand, 3609959 - 3609855
Alignment:
| Q |
11 |
cacagaatacaggaggaccaaaatgttgagaatgaggagcaatattggagaatcaagattttcaactagttataaaaaaggaaaatgagcaaaataagtg |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3609959 |
cacagaatagaggaggaccaaaatgttgaaaatgaggagcaatattggagaatcaagattttcaactagttataaaaaaggaaaatgagcaaaataagtg |
3609860 |
T |
|
| Q |
111 |
actat |
115 |
Q |
| |
|
||||| |
|
|
| T |
3609859 |
actat |
3609855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 84 - 114
Target Start/End: Complemental strand, 3609852 - 3609822
Alignment:
| Q |
84 |
aaaaaaggaaaatgagcaaaataagtgacta |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3609852 |
aaaaaaggaaaatgagcaaaataagtgacta |
3609822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University