View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_42 (Length: 378)
Name: NF13040_low_42
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 16 - 261
Target Start/End: Original strand, 38740462 - 38740706
Alignment:
| Q |
16 |
acatttatataggtcatgagcaacggacagggtaatttgtgacatatcatctccggcgcagcacttaagcattttattattgtgtaaaatggttctggaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38740462 |
acatttatataggtcatgagcaacggacagggtaatttgtgacatatcatctccggcgcagcacttaagcattttattattgtgtaaaatgattctggaa |
38740561 |
T |
 |
| Q |
116 |
gcctgcaaatatatgaagattttagagatactaaaggaattaattaaaagtattacttctagacaannnnnnnctatacatcaaagacatatatgttact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
38740562 |
gcctgcaaatatatgaagattttagagatactaaaggaattaattaaaagtattacttcaagacaatttttttctatacatc-aagacatatatgttact |
38740660 |
T |
 |
| Q |
216 |
cgtnnnnnnncatgtgttaaatgtatctttgaaggtatagtttaag |
261 |
Q |
| |
|
||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38740661 |
cgtaaaaaaacacgtgttaaatgtgtctttgaaggtatagtttaag |
38740706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University