View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_50 (Length: 344)
Name: NF13040_low_50
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 16 - 328
Target Start/End: Original strand, 46185699 - 46186011
Alignment:
| Q |
16 |
cactgtgaattctaaaaagtattgtactctatcatcaaatgataaatttgctttcattttcatagccgaaacacgaaggttaccaaattctagaataatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185699 |
cactgtgaattctaaaaagtattgtactctatcatcaaatgataaatttgctttcattttcatagccgaaacacgaaggttaccaaattctagaataatg |
46185798 |
T |
|
| Q |
116 |
aacttgtataaattccctgattcttcagcaagatcaactaatgaacttgctttttgttgtgcatgcacccttcttaaaatcttttggtacgtagcatcct |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185799 |
aacttgtataaattctctgattcttcagcaagatcaactaatgaacttgctttttgttgtgcatgcacccttcttaaaatcttttggtacgtagcatcct |
46185898 |
T |
|
| Q |
216 |
tggtccaatgttgcagaatgaaatgatcagggatttgcacaataccttttgattgaaaaatcccatgaattcatatagtggcagccacatttagcaactc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46185899 |
tggtccaatgttgcagaatgaaatgatcagggatttgcacaataccttttgattgaaaaatcccatgaattcatatagtggcagccacatttagcaactt |
46185998 |
T |
|
| Q |
316 |
ctggcctaaatct |
328 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46185999 |
ttggcctaaatct |
46186011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University