View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_54 (Length: 310)
Name: NF13040_low_54
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 10 - 293
Target Start/End: Complemental strand, 28605288 - 28605005
Alignment:
| Q |
10 |
gcacagagtggataccttattagcttctgtttcaatttcctttttgggtctgctttgcgccctgctgctgttattgttgactgttgaatgtggattagca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28605288 |
gcacagagtggataccttattagcttctgtttcaatttcctttttgggtctgctttgcgccctgctgttgttattgttgactgttgaatgtggattagca |
28605189 |
T |
 |
| Q |
110 |
agggagttttgttcaagctcattcagtggatttcttctgtatggtgattcttctgcttttctcgaggagctgcggctaagtgatgactgacttgttgcat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605188 |
agggagttttgttcaagctcattcagtggatttcttctgtatggtgattcttctgctttcctcgaggagctgcggctaagtgatgactgacttgttgcat |
28605089 |
T |
 |
| Q |
210 |
tcccatttgctcttgcaggcgattgagaacgcggtgaaccaacatttctcctaactgtaatcctcttcacaccaattgtacctg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28605088 |
tcccatttgctcttgcaggcgattgagaacgcggtgaaccaacatttctcctaactgtaatcctcttcacaccaattgtacctg |
28605005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University