View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_65 (Length: 281)
Name: NF13040_low_65
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 3658596 - 3658340
Alignment:
| Q |
9 |
agcatagggtctttggcagcagtgactgttcttgtgtacatacaagataaccaaggtagaggttggggttacggtatttgtgcggtcgcaattgtggttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3658596 |
agcatagggtctttggcagcagtgactgttcttgtgtacatacaagataaccaaggtagaggttggggttacggtatttgtgcggtcgcaattgtggttg |
3658497 |
T |
 |
| Q |
109 |
cgctccttgttttcttgtccggtacccgcaagtaccggatcaagcaacttgtcggtagtcctttgactcagattgcggtcgtgtttgtggctgcttggag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3658496 |
cgctccttgttttcttgtccggtacccgcaagtaccggatcaagcaacttgtcggtagtcctttgactcagattgcggtcgtgtttgtggctgcttggag |
3658397 |
T |
 |
| Q |
209 |
gaagagacacatgcaattgccctctgattcttcattgctctatgaagaggatgatat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3658396 |
gaagagacacatgcaattgccctctgattcttcattgctctatgaagaggatgatat |
3658340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 3646010 - 3645923
Alignment:
| Q |
162 |
ggtagtcctttgactcagattgcggtcgtgtttgtggctgcttggaggaagagacacatgcaattgccctctgattcttcattgctct |
249 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||| |||||||| ||||||||| |
|
|
| T |
3646010 |
ggtagtcccttgactcagattgcggtagtgtttgtggccgcttggaggaagaggcacttgcaattgccttctgattccgcattgctct |
3645923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 162 - 214
Target Start/End: Original strand, 41873045 - 41873097
Alignment:
| Q |
162 |
ggtagtcctttgactcagattgcggtcgtgtttgtggctgcttggaggaagag |
214 |
Q |
| |
|
||||||||||||||||||||||| || || | ||||||||||||||||||||| |
|
|
| T |
41873045 |
ggtagtcctttgactcagattgcagtggtttatgtggctgcttggaggaagag |
41873097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University