View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_70 (Length: 273)
Name: NF13040_low_70
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 13 - 254
Target Start/End: Complemental strand, 27850014 - 27849774
Alignment:
| Q |
13 |
taaattatatttggcttgtatatatcaatactaaaaaacaaactatttttcttattgaaatcactttgaatttatgagtgtgtttggtttagcttttgca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27850014 |
taaattatatttggcttgtatatatcaatactaaaaaacaaactatttttcttattgaaatcactttgaatttatgagtgtgtttggtttagcttttgca |
27849915 |
T |
 |
| Q |
113 |
gacgtgcatttaccatgccactttgccgtagcttgtacatttactaccattcctaccacggaaacaaacgtgagcatgtacattttactcaagcgctttg |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
27849914 |
gacgtgcatttaccattccactttgccgtagcttgtacatttactaccattcctaccacggaaacaaacgtgagcatgtaca-ttcactcaagcgctttg |
27849816 |
T |
 |
| Q |
213 |
ccaatgaatcatggagtcatcttttagtgactatcactaacc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27849815 |
ccaatgaatcatggagtcatcttttagtgactatcactaacc |
27849774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University