View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_72 (Length: 272)
Name: NF13040_low_72
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 41 - 254
Target Start/End: Original strand, 51402057 - 51402268
Alignment:
| Q |
41 |
aaaggagtaattaatagttaattagttacatttaatttgaaaatgctgaatatagtaaagaaacaaagtcaaaagataaacaccacacgtagaaaagcag |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51402057 |
aaaggagtaattaatagttaattagttacatttaatttgaaaatgctgaatatagtaaagaaacaaagtcaaaagataaacaccacacgtagaaaagcag |
51402156 |
T |
 |
| Q |
141 |
tatatggcatggttttcgtttaaatacttccgcttgttcttttgaatctcactactataagctgtgacattaacttctttctttggtcttatctgtaagc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51402157 |
tatatggcatggttttcgtttaaatacttccgcttgttcttttgaatctcactac--taagctgtgacattaacttctttctttggtcttatctgtaagc |
51402254 |
T |
 |
| Q |
241 |
cacgtatataacgt |
254 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
51402255 |
cacgtatataacgt |
51402268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University