View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_76 (Length: 265)
Name: NF13040_low_76
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 250
Target Start/End: Complemental strand, 5676135 - 5675902
Alignment:
| Q |
18 |
gaatcttgagcattgaatgaacatcggaccccttgtgttttcctatcattaaattgattatgaatacaacacaaagtacaagctaaaa-tctttatccaa |
116 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5676135 |
gaatcttgaccattgaatgaagatcggaccgcttgtgttttcctatcattaaattgattatgaatacaacacaaagtacgagctaaaaatctttatccaa |
5676036 |
T |
 |
| Q |
117 |
tggtcgagattcataagtgcagtgactatgagagtattcggatacctctcgttggaacaataaaacaagtcttcacattctattgatcaagatgatataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5676035 |
tggtcgagattcataagtgcagtgactatgagagtattcggatacctcacgtgggaacaataaaacaagtcttcacattctattgatcaagataatataa |
5675936 |
T |
 |
| Q |
217 |
taactacctaaaataattctcttgagcttcatct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5675935 |
taactacctaaaataattctcttgagcttcatct |
5675902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University