View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_79 (Length: 263)
Name: NF13040_low_79
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_79 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 23853171 - 23853420
Alignment:
| Q |
1 |
gagactgaagcagagctgcaagtcgggtgggcacaacacaaccgtgacacaaccaacacaacttaaataggcatctcattttattatgtcctttcatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853171 |
gagactgaagcagagctgcaagtcgggtgggcacaacacaaccgtgacacaaccaacacaacttaaataggcatctcattttattatgtcctttcatttg |
23853270 |
T |
 |
| Q |
101 |
ttcatttttatatttggaacgagtcatgttgatgttctatttccgtgcatatcttgagcacttatttatatttggggacaccttatattcaaacacaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23853271 |
ttcatttttatatttggaacgagtcatgttgatgttctatttccgtgcatatcttgagcacttatttatatttggggacaccttatattcaaacacaatt |
23853370 |
T |
 |
| Q |
201 |
gagtctctatgtaattgaactctagttaattggtatctatgatgatgtcc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
23853371 |
gagtctctatgtaattgaactctagttaattggtatctatgttgatgtcc |
23853420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University