View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13040_low_84 (Length: 252)
Name: NF13040_low_84
Description: NF13040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13040_low_84 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 91 - 241
Target Start/End: Complemental strand, 5762888 - 5762738
Alignment:
| Q |
91 |
tgcataataagtaaaagactataaaatctataacattataacttttccaaacatattcaatctagaagagtttgttttgggaagtccatcctaaaaatgc |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5762888 |
tgcataataagtaaaagactataaaatctataacattataacttttccaaacatattcaatctagaagagtttgttttgggaagtccatcctaaaaatgt |
5762789 |
T |
|
| Q |
191 |
agaattttattttttgggaacaaaacaaatgtagattgtttttatcttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5762788 |
agaattttattttttgggaacaaaacaaatgtagattgtttttatcttcat |
5762738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 5762980 - 5762945
Alignment:
| Q |
1 |
ttatgaaaatcaaatgcataataagtattcaactta |
36 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5762980 |
ttatgaaaattaaatgcataataagtattcaactta |
5762945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University