View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13041_high_10 (Length: 203)
Name: NF13041_high_10
Description: NF13041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13041_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 37 - 195
Target Start/End: Original strand, 10496812 - 10496970
Alignment:
| Q |
37 |
tgcatatttttaatgaaatttattttgatgcctcatctcaacannnnnnnnctggctccgccacgacaagctggtttatgttatctcttcttgcaactct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10496812 |
tgcatatttttaatgaaatttattttgatgcctcatctcaacattttttttctggctccgccacgacaagctggtttatgttatctcttcttgcaactct |
10496911 |
T |
|
| Q |
137 |
acaactttctctcaataaaattgtgtggatttacattctttttatttctgatgatgtcc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10496912 |
acaactttctctcaataaaattgtgtggatttacattctttttatttctggtggtgtcc |
10496970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 37 - 179
Target Start/End: Original strand, 10497001 - 10497142
Alignment:
| Q |
37 |
tgcatatttttaatgaaatttattttgatgcctcatctcaacannnnnnnnctggctccgccacgacaagctggtttatgttatctcttcttgcaactct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||| |||||||||| | ||||||| |
|
|
| T |
10497001 |
tgcatatttttaatgaaatttattttgatagctcatctcaacattttttt-ctggctccgccacgacaagttggtttatattatctcttcgtacaactct |
10497099 |
T |
|
| Q |
137 |
acaactttctctcaataaaattgtgtggatttacattcttttt |
179 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10497100 |
acaacttgctctcaataaaattgtgtggatttacatttttttt |
10497142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 40 - 169
Target Start/End: Original strand, 10496627 - 10496755
Alignment:
| Q |
40 |
atatttttaatgaaatttattttgatgcctcatctcaacannnnnnnnctggctccgccacgacaagctggtttatgttatctcttcttgcaactctaca |
139 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
10496627 |
atatttttaataaaatttattttgatggctcatctcaccattttttt-ctggctccgccacgacaagctggtttatgttatctcttcgtggaactctaca |
10496725 |
T |
|
| Q |
140 |
actttctctcaataaaattgtgtggattta |
169 |
Q |
| |
|
|||| |||||||||||||||||| |||||| |
|
|
| T |
10496726 |
acttgctctcaataaaattgtgtagattta |
10496755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University