View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13041_high_3 (Length: 380)
Name: NF13041_high_3
Description: NF13041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13041_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 9 - 195
Target Start/End: Complemental strand, 47838398 - 47838213
Alignment:
| Q |
9 |
acatcatcaaaatttgttttaagctttacttttgaagattgttgggttggctggctcttcccattttaaagcttataaaattcaactctttatcttttat |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47838398 |
acattatcaaaatttgttttaagctttacttttgaagattat-gggttggctgactcttcccattttaaagcttataaaattcaactctttatcttttat |
47838300 |
T |
 |
| Q |
109 |
aaaacatattaacagttagaatttcatcttttaaaataaataagtgaaaaaatcaaaactggaatcaagatgcaatgtatatattaa |
195 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47838299 |
aaaacatattaactgttagaatttcatcttttaaaataaataagtgaaaaaatcaaaactggaatcaagatgcaatgtatatattaa |
47838213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University