View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13041_low_10 (Length: 204)
Name: NF13041_low_10
Description: NF13041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13041_low_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 43823464 - 43823261
Alignment:
| Q |
1 |
tttaaatattgcagatggtggtggcggtagtggtagtggttatgatgatgattctgtgcatacattcactggtcatgaaggtcagccttctactctattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
43823464 |
tttaaatattgcagatggtggtggcggtggtggtagtggttatgacgatgattctgtgcatacattcaccggtcatgaaggtctgccttctactctattt |
43823365 |
T |
 |
| Q |
101 |
gtttatgnnnnnnnnnnnnnccgtcctggtttgattgggttgggaacccaggacttgtagtgtgcttctctttaggtttcatgttcaaatcccccatgta |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823364 |
gtttatgttttttcccttttccgtcctggtttgattgggttgggaacctaggacttgtagtgtgcttctctttaggtttcatgttcaaatcccccatgtg |
43823265 |
T |
 |
| Q |
201 |
gtaa |
204 |
Q |
| |
|
|||| |
|
|
| T |
43823264 |
gtaa |
43823261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University