View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13042_high_23 (Length: 243)
Name: NF13042_high_23
Description: NF13042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13042_high_23 |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 134 - 243
Target Start/End: Original strand, 7062831 - 7062940
Alignment:
| Q |
134 |
acacatcaaataaaattttgtcaacacttctcaagcataattcttttgatgttaccacgctattaggaaatcatttgtaatctaaatatctggctctcga |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7062831 |
acacatcaaataaaattttgtcaacacttctcaagcataattcttttgatgttaccacgctattaggaaatcatttgtaatctaaatatctggctctcaa |
7062930 |
T |
 |
| Q |
234 |
ctgtagttct |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
7062931 |
ctgtagttct |
7062940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 7062667 - 7062721
Alignment:
| Q |
18 |
ccttgtttctcttttggcatccatcaggttagaccttctattgatttatccaact |
72 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7062667 |
ccttgtttctcttttggcatccatcagttgagaccttctattgatttatccaact |
7062721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 102
Target Start/End: Original strand, 7062799 - 7062830
Alignment:
| Q |
71 |
cttctctttaattgtcttttcaaggttcatgt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7062799 |
cttctctttaattgtcttttcaaggttcatgt |
7062830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University