View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13042_low_18 (Length: 258)
Name: NF13042_low_18
Description: NF13042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13042_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 12242399 - 12242213
Alignment:
| Q |
18 |
attagcagttgcaacaatggaatgtaatgggaaccctcatgctcctttgtgtagcaaaagcatatttggtgtttattgcactcgagtcttcttagcttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12242399 |
attagcagttgcaacaatggaatgtaatggaaaccctcatgctcctttgtgtagcaaaagcatatttggtgtttattgcactcgagtcttcttagcttgt |
12242300 |
T |
|
| Q |
118 |
ggaattagcttggctggctcactcttttacatctctcagctattatggtgcatcctcagagcatttaattcagattaatatttaggg |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12242299 |
ggaattagtttggctggctcactcttttacatctctcagctattatggtgcatcctcaaagcatttaattcagattaatatttaggg |
12242213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University