View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13043_high_17 (Length: 216)

Name: NF13043_high_17
Description: NF13043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13043_high_17
NF13043_high_17
[»] chr7 (1 HSPs)
chr7 (1-37)||(11914060-11914096)


Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 11914096 - 11914060
Alignment:
1 aaaactgatgatatctgcgatgatgtttgtggccagg 37  Q
    |||||||||||||||||||||||||||||||||||||    
11914096 aaaactgatgatatctgcgatgatgtttgtggccagg 11914060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University