View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13043_low_12 (Length: 302)
Name: NF13043_low_12
Description: NF13043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13043_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 23786419 - 23786345
Alignment:
| Q |
1 |
gatgacgaaacaaaacgaggaatcttgttcttgttgttggtgggaataatagaagaaacagcagcagcaccagca |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
23786419 |
gatgacgaaacaaaacgaggaatcttgttcttgttgttggtgggaataatagaacaaacagcagcagcagcagca |
23786345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Complemental strand, 23786328 - 23786282
Alignment:
| Q |
74 |
caccaccaccaccatatgatcttcttaaaattgaaaacattgttgca |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23786328 |
caccaccaccaccatataatcttcttaaaattgaaaacattgttgca |
23786282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 164 - 229
Target Start/End: Original strand, 24621923 - 24621983
Alignment:
| Q |
164 |
agggaaccagcgatcttatttatatctagggataagaaggttaaacaaatttactaacttatttat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
24621923 |
agggaaccagcgatcttatttatatctagg-----gagggttaaacaaatttactaacttatttat |
24621983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 238 - 284
Target Start/End: Original strand, 44722759 - 44722805
Alignment:
| Q |
238 |
ctaggatgaggtagctaataggtccctcactagtgagggagtaaaaa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44722759 |
ctaggatgaggtagctaataggtccctcaccagtgagggagtaaaaa |
44722805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 5527951 - 5527899
Alignment:
| Q |
232 |
tgacggctaggatgaggtagctaataggtccctcactagtgagggagtaaaaa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5527951 |
tgacggctaggatgaggtagctaataggtccctcaccgatgagggagtaaaaa |
5527899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 226 - 284
Target Start/End: Original strand, 23876722 - 23876780
Alignment:
| Q |
226 |
ttatggtgacggctaggatgaggtagctaataggtccctcactagtgagggagtaaaaa |
284 |
Q |
| |
|
|||||||| ||||||||||||||||| | |||||||||||||| |||||| |||||||| |
|
|
| T |
23876722 |
ttatggtggcggctaggatgaggtagttgataggtccctcactggtgaggtagtaaaaa |
23876780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 234 - 284
Target Start/End: Complemental strand, 7420 - 7370
Alignment:
| Q |
234 |
acggctaggatgaggtagctaataggtccctcactagtgagggagtaaaaa |
284 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
7420 |
acggctaggatgaggtagctaataggtctctcactgatgatggagtaaaaa |
7370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 284
Target Start/End: Complemental strand, 3798070 - 3798016
Alignment:
| Q |
230 |
ggtgacggctaggatgaggtagctaataggtccctcactagtgagggagtaaaaa |
284 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||| |||||| |||||||| |
|
|
| T |
3798070 |
ggtgacggctatgatgaggtagctaataggtacttcaccggtgaggaagtaaaaa |
3798016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University