View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13043_low_15 (Length: 257)
Name: NF13043_low_15
Description: NF13043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13043_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 14996530 - 14996763
Alignment:
| Q |
1 |
tgattcacatcatgttgaaactccgctccgttgtcaatgtgcgacatttttagagttcagataatgtttaaccttgaagttcaaaggaacggtttgtgta |
100 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14996530 |
tgattcacatcatgtcgaaactccgccccgttgtcaatgtgcgacatttttagagttcagatactgtttaaccttgaagtacaaaggaacggtttgtgta |
14996629 |
T |
 |
| Q |
101 |
gtgatatttgctaattgtggtggtgtattgtaaagattaagagaaaggaagatatttttatgatttttctattgattggtttcaaggaagaagagggaga |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14996630 |
gtgatatttgctaattgtggtggggtattgtaaagatgaagagaaaggaagatatttttatgatttttctattgattggtttcaaggaagaggagggaga |
14996729 |
T |
 |
| Q |
201 |
taaagtatttcattagtatgtagaagaagaaact |
234 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
14996730 |
taaagtatttcattagtatgtagcagaagaaact |
14996763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University