View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13043_low_17 (Length: 244)
Name: NF13043_low_17
Description: NF13043
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13043_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 232
Target Start/End: Original strand, 40960914 - 40961126
Alignment:
| Q |
20 |
gtaaagtgggtgtaagggatattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40960914 |
gtaaagtgggtgtaagggatattattcgtgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaact |
40961013 |
T |
 |
| Q |
120 |
catctaatgcacttttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcttcttgtgatgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40961014 |
catctaatgcacttttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcctcttgtgatgc |
40961113 |
T |
 |
| Q |
220 |
ggtgtctgtgctg |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40961114 |
ggtgtctgtgctg |
40961126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 231
Target Start/End: Original strand, 40947740 - 40947931
Alignment:
| Q |
34 |
agggatattattcgcgcaggacttgctgaccgatatatggtttgcaccttaatgctttactgatatttaattaaaatttaaaaactcatctaatgcactt |
133 |
Q |
| |
|
||||||||||| || |||||| |||||||||||||||||| || |||||||||||||||||||||| | ||| | ||| |||||| || | || |
|
|
| T |
40947740 |
agggatattatccgtgcaggatatgctgaccgatatatggtcagcgccttaatgctttactgatatttca----aatatcaaat-tcatctcctgtagtt |
40947834 |
T |
 |
| Q |
134 |
ttaatgacccgggttttgattgttgctctgcttgttcagctggaatgtatcgcctgtggtcattcttggtctgcttcttgtgatgcggtgtctgtgct |
231 |
Q |
| |
|
|| |||| ||||| ||| ||||||||||||||||||||||||| || || ||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
40947835 |
tttgtgacttcggttta-atttttgctctgcttgttcagctggaatgcatagcttgtggtcattcctggtctgcctctcgtgatgcggtgtctgtgct |
40947931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University