View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_high_28 (Length: 339)
Name: NF13044_high_28
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_high_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 141 - 323
Target Start/End: Original strand, 12117597 - 12117777
Alignment:
| Q |
141 |
aaatgtttggatgaacttctttaagcttgtaagaattataaaattcttttctatatttaattgaannnnnnncatattaactacatgttaatataaattg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |||| ||||||||||| |
|
|
| T |
12117597 |
aaatgtttggatgaacttctttaagcttgtaagaattataaaattcttttctatatttaattgaattattttcat--taactagatgtaaatataaattg |
12117694 |
T |
|
| Q |
241 |
ggctaaaatctactcctatttagcccaacaatgattaaattctcttaattgaacatgatacaataattacattgctagtacat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12117695 |
ggctaaaatctactcctatttagcccaacaatgattaaattctcttaattgaacatgatacaataattacatagctagtacat |
12117777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 12117458 - 12117504
Alignment:
| Q |
1 |
cttataggtgcatattaatgcaaatatctaacacgatcttcccttat |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12117458 |
cttataggtgcatattaatgcaaatatctaacacgatctttccttat |
12117504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University