View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_high_39 (Length: 247)
Name: NF13044_high_39
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 12117375 - 12117143
Alignment:
| Q |
7 |
gaattttttactcccttaaaaggaactttatgcagaaaaggaatgaatgcagcagatgaaagtattccccatgcaagttactactactactttctttgat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12117375 |
gaattttttactcccttaaaaggaactttatgcagaaaaggaatgaatgcagcagatgaaagtattacccatgcaagttactactactactttctttgat |
12117276 |
T |
 |
| Q |
107 |
at---aagcatctcaaaacctgaaaagtttataagtagccaatttcctctcttataatttaatataagcatttggtgaaggtcctaattcccatataaaa |
203 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12117275 |
atatgatgcatctcaaaacctgaaaagtttataagtagccaatttcctctctgataattta--ataagcatttggtgaaggtcctaattcccatataaaa |
12117178 |
T |
 |
| Q |
204 |
ttcaaaacacactaataaaatgttcgaattatatt |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
12117177 |
ttcaaaacacactaataaaatgttcggattatatt |
12117143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University