View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_26 (Length: 359)
Name: NF13044_low_26
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 42229861 - 42230085
Alignment:
| Q |
1 |
tattgctgacgcatgcaggactgtacaatagcagatatggtccaggttatcgtgacactgactatggtgttggaggaggagctactggagatccaatgca |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42229861 |
tattgctgacccatgcaggactgtacaatagcagatatggtccaggttatcgtgacactgactatggtgttggaggaggagctactggagatccaatgca |
42229960 |
T |
 |
| Q |
101 |
caagggtggtcctgttggtggcacacgtgtttaaataaacatcattatccatataactacactttgtttcttg-tttttaataatattgtagtctcctag |
199 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
42229961 |
caagggtggtcctgttggtggcactcgtgtttaaataaatatcattatccatataactacactttgtttcttgttttttaataatattgtagtttcctag |
42230060 |
T |
 |
| Q |
200 |
tttgggacacgggactatgttcctg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42230061 |
tttgggacacgggactatgttcctg |
42230085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 252 - 352
Target Start/End: Original strand, 42230113 - 42230213
Alignment:
| Q |
252 |
gggtttgttgtatgaagagtgtcactttgtagcattacgttgtgtataccaatggctgcaattaatcatgtatttgcaatttgcttatttctgttcttct |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42230113 |
gggtttgttgtatgaagagtgtcactttgtagcattacattgtgtataccaatggctgcaattaatcatgtatttgcaatttgcttatttctgttcttct |
42230212 |
T |
 |
| Q |
352 |
c |
352 |
Q |
| |
|
| |
|
|
| T |
42230213 |
c |
42230213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University