View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_34 (Length: 288)
Name: NF13044_low_34
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 12 - 246
Target Start/End: Original strand, 43843531 - 43843766
Alignment:
| Q |
12 |
acatcatcaggtcgtgtgatacgtcatatctttttcaagtcaannnnnnngagaaatagaccaaatctaggtgattttaaaatggagtaaccaatttccc |
111 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43843531 |
acatcatcaagttgtgtgatacgtcatatctttttcaagttatttctttttagaaatagaccaaatctaggtgattttaaaatggagtaaccaatttccc |
43843630 |
T |
 |
| Q |
112 |
caagtgggcaaaaataagggaaaataaatagttactgtgcttatatttaagctagcgtttttgtttctgtctttatttattgc-gtaaaacgtgtaaatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43843631 |
caagtgggcaaaaataagggaaaataaatagttactgtgcttatatttaagctagcgtttttgtttctgtctttatttattgcggtaaaacgtgtaaatt |
43843730 |
T |
 |
| Q |
211 |
atnnnnnnnntataatgtaaattcatacttttcttt |
246 |
Q |
| |
|
|| | |||||||||||||||||||||||| |
|
|
| T |
43843731 |
ataaaaaaaatctaatgtaaattcatacttttcttt |
43843766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University