View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_36 (Length: 280)
Name: NF13044_low_36
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 101 - 274
Target Start/End: Complemental strand, 43607476 - 43607303
Alignment:
| Q |
101 |
cctacgtcacgttgatcattttgggcctcctgaactttatcttgggcctcctgaaccttatcttgggccatgctttcaacacgatcacgatcttccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607476 |
cctacgtcacgttgatcattttgggcctcctgaactttatcttgggcctcctgaaccttatcttgggccatgctttcaacacgatcacgatcttccaaat |
43607377 |
T |
 |
| Q |
201 |
taatctgagattcatgccccaaagtctcatccgcatccaaacgtggcggctttgcaattgcatgatgatgatgt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43607376 |
taatctgagattcatgccccaaagtctcatccgcatcaaaacgtggcggctttgcaattgcatgatgatgatgt |
43607303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 43607560 - 43607505
Alignment:
| Q |
17 |
actcctcatacgtcatagtaaactcttattcacttaacgaaccaaactcatgaaga |
72 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43607560 |
actcctcatacgtcatagtaaactcttgttcacttaacgaaccaaactcatgaaga |
43607505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University