View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13044_low_42 (Length: 242)

Name: NF13044_low_42
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13044_low_42
NF13044_low_42
[»] chr1 (1 HSPs)
chr1 (18-242)||(42229522-42229766)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 42229522 - 42229766
Alignment:
18 gttcttggtatagtgtcgaaatttatgggtgcaaatcatctcaggttttggaggagtgacagtttagcatctgctggagctacatcagtcattgcttggg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42229522 gttcttggtatagtgtcgaaatttatgggtgcaaatcatctcaggttttggaggagtgacagtttagcatctgctggagctacatcagtcattgcttggg 42229621  T
118 ctgttactgctctagccatggggtacattaaacctctaatcattcgttattatg--------------------aaaacacaaacacgaacaccagacac 197  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||                    ||||||| ||||||||||||||||||    
42229622 ctgttactgctctagccatggggtacattaaacatctaatcattcgttattatgaaaacacgaacaccagacacaaaacacgaacacgaacaccagacac 42229721  T
198 atactaactattatacatttgctatgcattatgaataggttggct 242  Q
    ||||||||||| |||||||||||||||||||||||||||||||||    
42229722 atactaactataatacatttgctatgcattatgaataggttggct 42229766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University