View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_42 (Length: 242)
Name: NF13044_low_42
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 42229522 - 42229766
Alignment:
| Q |
18 |
gttcttggtatagtgtcgaaatttatgggtgcaaatcatctcaggttttggaggagtgacagtttagcatctgctggagctacatcagtcattgcttggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42229522 |
gttcttggtatagtgtcgaaatttatgggtgcaaatcatctcaggttttggaggagtgacagtttagcatctgctggagctacatcagtcattgcttggg |
42229621 |
T |
 |
| Q |
118 |
ctgttactgctctagccatggggtacattaaacctctaatcattcgttattatg--------------------aaaacacaaacacgaacaccagacac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
42229622 |
ctgttactgctctagccatggggtacattaaacatctaatcattcgttattatgaaaacacgaacaccagacacaaaacacgaacacgaacaccagacac |
42229721 |
T |
 |
| Q |
198 |
atactaactattatacatttgctatgcattatgaataggttggct |
242 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42229722 |
atactaactataatacatttgctatgcattatgaataggttggct |
42229766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University