View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_43 (Length: 239)
Name: NF13044_low_43
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 6881415 - 6881624
Alignment:
| Q |
15 |
aattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagagattgtttatatgtcagtttggtaaatacaggattcggttacag |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
6881415 |
aattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagagattgtttatatgtcagtttggtaaatacagaattcggttacgg |
6881514 |
T |
 |
| Q |
115 |
ttgaacctgaattctcagtactgaattgcacatcagaattgaacaagtttactatcaactttaaggcaaccatagtctatatg-ctatcattgatttgga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6881515 |
ttgaacctgaattctcagtactgaattgcacatcagaattgaacaagtttactatcaactttaaggcaaccatagtctatatgtctatcattgatttgga |
6881614 |
T |
 |
| Q |
214 |
tactgaatac |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
6881615 |
tactgaatac |
6881624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University