View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13044_low_43 (Length: 239)

Name: NF13044_low_43
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13044_low_43
NF13044_low_43
[»] chr7 (1 HSPs)
chr7 (15-223)||(6881415-6881624)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 6881415 - 6881624
Alignment:
15 aattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagagattgtttatatgtcagtttggtaaatacaggattcggttacag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |    
6881415 aattctccatagtattcttgagtaaaagagattatgagcagagtagaataaagagagattgtttatatgtcagtttggtaaatacagaattcggttacgg 6881514  T
115 ttgaacctgaattctcagtactgaattgcacatcagaattgaacaagtttactatcaactttaaggcaaccatagtctatatg-ctatcattgatttgga 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
6881515 ttgaacctgaattctcagtactgaattgcacatcagaattgaacaagtttactatcaactttaaggcaaccatagtctatatgtctatcattgatttgga 6881614  T
214 tactgaatac 223  Q
    ||||||||||    
6881615 tactgaatac 6881624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University