View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13044_low_44 (Length: 238)
Name: NF13044_low_44
Description: NF13044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13044_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 3671977 - 3672183
Alignment:
| Q |
11 |
cgaagaatatgaagcataccgaaagtgctagatagaaaacgagcttgaaggaaaacttgcgaagctctttgaagagaaggtagcatagtacaatgaagct |
110 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3671977 |
cgaagaaaaggaagcataccgaaagtgctagatagaaaacgagcttgaaggaaaacttgcgaagctctttgaagagaaggtagcatagtacaatgaagct |
3672076 |
T |
 |
| Q |
111 |
tgaaccagcaaaagagagactcgacgcgccgacgtttactgcggtgagaatcccacgatcggaggcggtaagtgtggtgctgatggcggcggaggtcgcc |
210 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3672077 |
tgaaccagcgaaagagagactcgacgcgccgacgtttactgcggtgagaatcccacgatcggaggcggtaagtgtggtgctgatggcggcggtggtcgcc |
3672176 |
T |
 |
| Q |
211 |
attgcgg |
217 |
Q |
| |
|
||||||| |
|
|
| T |
3672177 |
attgcgg |
3672183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University