View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13045_low_5 (Length: 301)
Name: NF13045_low_5
Description: NF13045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13045_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 57 - 283
Target Start/End: Original strand, 558991 - 559222
Alignment:
| Q |
57 |
acatggaaacagccaatgagacatattcttttgtaagagtctctttggttaaaacaagagattcttagaaaaattgattaaatt-------gtcagtggc |
149 |
Q |
| |
|
||||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||| |
|
|
| T |
558991 |
acatgaaaaaagcccatgagacat--tcttttgtaagagtctctttggttaaaacaagagattcttagaaaaatagattaaactttaaagtgtcagtggc |
559088 |
T |
 |
| Q |
150 |
ttgactgaagtttgttgagataaaatggtaggaggtgtttgtggtttatttattggtttggctaacctatttagaatctcttgtctgctaattaatcttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
559089 |
ttgactgaagtttgttgagataaaatgctaggaggtgtttgtgttttatttattggtttggctaacctatttaaaatctcttgtctgctaattaatcttt |
559188 |
T |
 |
| Q |
250 |
caaacatttcatgattgagatggtcaattctact |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
559189 |
caaacatttcatgattgagatggtcaattctact |
559222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 533409 - 533457
Alignment:
| Q |
194 |
tttatttattggtttggctaacctatttagaatctc-ttgtctgctaat |
241 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
533409 |
tttaattattggttgggctaaccaatttagaatctctttgtctgctaat |
533457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University