View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13047_high_3 (Length: 372)
Name: NF13047_high_3
Description: NF13047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13047_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 14 - 76
Target Start/End: Original strand, 40189985 - 40190047
Alignment:
| Q |
14 |
gcttagcttagaggagcagcaaaggtgaggttggcctgctctaccacattattgcaatgccac |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40189985 |
gcttagcttagaggagcagcaaaggtgaggttggcctgctctaccacattattgcaatgccac |
40190047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University