View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13048_high_5 (Length: 213)
Name: NF13048_high_5
Description: NF13048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13048_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 43927110 - 43927301
Alignment:
| Q |
20 |
tgaatccaccatctccattgacaaatacttcatcagaaacaaccccaaattcaccatgccccttgacaaaatgtgaacctgcatgcaca----------- |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43927110 |
tgaatccaccatctccattgacaaatacttcatcagaaacaaccccaaattcaccatgccccttgacaaaatgtgaacctgcatgcacattgcattcact |
43927209 |
T |
|
| Q |
109 |
ttgttatatctgagcgtgacaggcaaactaattaatagcaatagtttaaccaaagttacataatcaatcacaatcatatactgatattcttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43927210 |
ttgttatatctgagcgtgacaggcaaactaattaatagcaatagtttaaccaaagttacataatcaatcacaatcatatactgattttcttc |
43927301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University