View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13048_low_7 (Length: 264)

Name: NF13048_low_7
Description: NF13048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13048_low_7
NF13048_low_7
[»] chr3 (1 HSPs)
chr3 (16-207)||(49577916-49578107)
[»] chr8 (1 HSPs)
chr8 (170-199)||(31579232-31579261)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 207
Target Start/End: Complemental strand, 49578107 - 49577916
Alignment:
16 ataaataagccaagtgaatggttgttagttgctacccaacaagatgcaggaaatgtaaatgagaaatgtgaggaaaaatctctttttaacactcttttta 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49578107 ataaataagccaagtgaatggttgttagttgctacccaacaagatgcaggaaatgtaaatgagaaatgtgaggaaaaatctctttttaacactcttttta 49578008  T
116 gtaagagagtatgtgttagaaaaaatatgaaaaatagagtgtccataacccttctaaatgcaaataatcaagttaaaatatgaccactagta 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49578007 gtaagagagtatgtgttagaaaaaatatgaaaaatagagtgtccataacccttctaaatgcaaataatcaagttaaaatatgaccactagta 49577916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 170 - 199
Target Start/End: Original strand, 31579232 - 31579261
Alignment:
170 taaatgcaaataatcaagttaaaatatgac 199  Q
    ||||||||||||||||||||||||||||||    
31579232 taaatgcaaataatcaagttaaaatatgac 31579261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University