View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_high_26 (Length: 250)
Name: NF13049_high_26
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 36 - 244
Target Start/End: Complemental strand, 32453707 - 32453499
Alignment:
| Q |
36 |
cctcctaaaagcatgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggcatcaacaccagatcggattccgactgca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32453707 |
cctcctaaaagcatgggtggtagaaacaaggagttgctgctgctgataatgcttgccttttcagttggtggcgtcaacaccagatcggattccgactgca |
32453608 |
T |
|
| Q |
136 |
aatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaacagtctgggtggggtttctttggttccgt |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
32453607 |
aatttggagcttttagattcaaatgtggcggtggtcggagacaacgtcgtggttcagtggcggtggacaaacggtctgggtggggtttctttggttccgt |
32453508 |
T |
|
| Q |
236 |
tcatctctg |
244 |
Q |
| |
|
|||| |||| |
|
|
| T |
32453507 |
tcatgtctg |
32453499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 109 - 239
Target Start/End: Original strand, 31670333 - 31670463
Alignment:
| Q |
109 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
31670333 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
31670432 |
T |
|
| Q |
209 |
gtctgggtggggtttctttggttccgttcat |
239 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
31670433 |
gtttggatggggtttgcttggttctgttcat |
31670463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 48 - 244
Target Start/End: Complemental strand, 36570772 - 36570573
Alignment:
| Q |
48 |
atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag |
144 |
Q |
| |
|
|||||| |||||||||||||||||| | ||||||||||| |||| |||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36570772 |
atgggtagtagaaacaaggagttgtggatgctgataatgtttgctttttcagttggtggtggtgtcaacaccagatcggattctgactgcaaatttggag |
36570673 |
T |
|
| Q |
145 |
cttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaacagtctgggtggggtttctttggttccgttcatctctg |
244 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| ||| | |||||||||||| |||||| ||| |||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
36570672 |
ctttaagattcaaacatggcggtggtcggagacaacatggtggttcagtggtggtggacaaaaagtctgggtggggtttgtttggttctgttcatgtctg |
36570573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 48 - 176
Target Start/End: Original strand, 52603837 - 52603968
Alignment:
| Q |
48 |
atgggtggtagaaacaaggagttgttgctgctgataatgcttgccttttcagttggtggca---tcaacaccagatcggattccgactgcaaatttggag |
144 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||| ||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
52603837 |
atgggtagtagaaacaaggagttgtggctgttgataatgtttgccttttcagttggtggtggggtcaacaccagaacggattctgactgcaaatttggag |
52603936 |
T |
|
| Q |
145 |
cttttagattcaaacgtggcggtggtcggaga |
176 |
Q |
| |
|
|||| |||||||||| |||||||||||||||| |
|
|
| T |
52603937 |
ctttaagattcaaacatggcggtggtcggaga |
52603968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 197 - 244
Target Start/End: Original strand, 52603975 - 52604022
Alignment:
| Q |
197 |
ggtggaaaaacagtctgggtggggtttctttggttccgttcatctctg |
244 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
52603975 |
ggtggacaaacagtctgggtggggtttgtttggttctgttcatgtctg |
52604022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 109 - 239
Target Start/End: Original strand, 35987066 - 35987196
Alignment:
| Q |
109 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
35987066 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
35987165 |
T |
|
| Q |
209 |
gtctgggtggggtttctttggttccgttcat |
239 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
35987166 |
gtttggatggggtttgcttggttctgttcat |
35987196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 109 - 239
Target Start/End: Original strand, 36008474 - 36008604
Alignment:
| Q |
109 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtggaaaaaca |
208 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| ||| | |
|
|
| T |
36008474 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
36008573 |
T |
|
| Q |
209 |
gtctgggtggggtttctttggttccgttcat |
239 |
Q |
| |
|
|| ||| |||||||| ||||||| |||||| |
|
|
| T |
36008574 |
gtttggatggggtttgcttggttctgttcat |
36008604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 109 - 239
Target Start/End: Complemental strand, 33047192 - 33047061
Alignment:
| Q |
109 |
tcaacaccagatcggattccgactgcaaatttggagcttttagattcaaacgtggcggtggtcggagataacgtcgtggttcagtggcggtgga-aaaac |
207 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| | |||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
33047192 |
tcaacaccagatcggattccaattgcaaatttggagctataagattcaaacacggcggtgctcggagacaacacggtggttcagtggcggtggacaaaaa |
33047093 |
T |
|
| Q |
208 |
agtctgggtggggtttctttggttccgttcat |
239 |
Q |
| |
|
||| ||| |||||||| ||||||| |||||| |
|
|
| T |
33047092 |
agtttggatggggtttgcttggttctgttcat |
33047061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University