View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_high_27 (Length: 249)
Name: NF13049_high_27
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 48671869 - 48672104
Alignment:
| Q |
1 |
cccattttcgtgataatgttactatgtttgatggattacatttcaaacgttttatcatatttatcaaacagcgccagacatgtttggnnnnnnngtggta |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48671869 |
cccattttcgtgataacgttactatgtttgatggattacatttcaaacgttttaccatatttatcaaacagcgccagacatgtttggttgttttgtggta |
48671968 |
T |
 |
| Q |
101 |
acattttgaaattcatagtgtattcgtaatannnnnnnaccattttaatcaaagatactagacgtatttttctaccacgcgttgattgtcttttacaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48671969 |
acattttgaaattcatagtgtattcgtaata-ttttttaccattttaatcaaagatactagacgtatttttctaccacgcgttgattgtcttttataata |
48672067 |
T |
 |
| Q |
201 |
acacttccaaggttgcaattatatgtacatgaatatt |
237 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
48672068 |
acactaccaaggttgcaactatatgtacatgaatatt |
48672104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University