View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13049_high_33 (Length: 216)
Name: NF13049_high_33
Description: NF13049
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13049_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 40799802 - 40799940
Alignment:
| Q |
18 |
tgatgcttcccaaaagtaccacatttacaaccataccagcatctatttacaaccacaatttctttttgagagcatcaactaacgtgtggccaattctcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40799802 |
tgatgcttcccaaaagtaccacatttacaaccataccagcatctatttacaaccacaatttctttttgagagcatcaactaatgtgtggccaattctcaa |
40799901 |
T |
 |
| Q |
118 |
ccacccaagtagcctaaccggtgtcccccacttgatata |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40799902 |
ccacccaagtagcctaaccggtgtcccccacttgatata |
40799940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University